Welcome, Guest. Please Login or Register
UGENE Bulletin Board
  Welcome to our forum.
  HomeHelpSearchLoginRegister  
 
 
Page Index Toggle Pages: 1
frequency matrix for generic sequences from file (Read 3489 times)
Sep 22nd, 2012 at 6:40pm

karen   Offline
YaBB Newbies

Posts: 1
*
 
Good morning,

I've just discovered UGENE and found in the documentation that a frequency matrix can be created from a file:
"To create a position weight or frequency matrix from an alignment or a file with several sequences, press the Build new matrix button in the Weight matrix search dialog, or select the Tools ‣ Weight matrix ‣ Build weight matrix program main menu item"

Below I pasted a FASTA representation, could the frequency matrix be created for it in UGENE?
Thanks so much for any hint.
Karen

>1001
CCCACCACCCCCACCACACCACACCACCCCAAA

>1003
CTCCTTCACTTTCAATTAACAAACAACCAAAATCCATAAAAACCCAAAAACTATACCTAATAATATTCTCCCT

>1005
CCCCTCTTCCCTTCCT

>1012
AACCAAACCAAACAAAATCAAACTAATAATAAAAATCAAAACATAACAAAAAACCCTCCCCAAACCAAATCATAATCCAA
AACCAACCTAAATCCTATTCCATCCACACAAACCCAAACTCAAA

>1017
CACAACACAATCAAACCAAAACAACCATCCCTCTCCATAACCAACAAACAACCAACCACCAACACAACCAAAACAAAACC
ACAAAAAACCAAACACAACCAAAACCACAACAACAAATCCT

>1022
CACCCACAACCCCACAACACAAACAACACACCCCACAA

>1024
AAAAAAAAACCCCAAAAACAAAAAACACCACCATCACTAATCCATCTCATACCAACCC

>1026
AAAAAAAAAACACAATCCTCCAACACAACCCACAACACAACAAAAAAACAACAAATCAATAAAAAATTTCTTCCCAAAAA
TTTCTAAAATCTATTTTCTTTTCTTACAAA

>1027
ATAATAACACAAAAAAAAAAAAAAACCACAAACAAAAAAACTTATTCATAATATTCCCCAAA

>1029
CCCCATCTCCCCCTCCCCCATCCCTCTCACTCCCCCCCTTTCCCTTTAAAAA

>1030
AAAAAATCCCCTTCCCCTTCCCCTTTCCTAATTATTCCCCCCCCCCCTTTTTCCCTCTTCTACACCAAATATCCCTTAAA
AATCCCCTCCAAACCTTTAACCCACCACAATTCTTTATTAT

>1033
CACACACCAAAAAATCACTATACC

>1035
AAAAAAACAAACCAAAAACAC

>1037
CTCCTACACACCCCTCCTT


>1044
CCCCACAACCTCCAATCACAACCCCCC

>1052
ATCCCACATCTACTTCATACACATACAAA

>1053
CCAACTCCCTCCCTCTCCTACCCCC

>1055
AAAAAAAAAAACCTAAACCAACAAAACCAAAAACTACAACACTACCAATTTCCTTTAAATTAAACCTTACC

>1057
CACACAACAAAACACTCCAAAACTCCACCTAACACCCAATCCACACACCCAAACACAAACAAAAATAAAAAAAAAACACC
AAAAAACCACAACAATCCCCAAA

>1067
CCCCAAACCCAAAAAAACCCCAAAACCCCCCCCCCCCCCTTCCTCTTATTATCCACTACCCCCAAAAATTAAATTAAAAT
TAATTAATATATAATCTATATTTCTTTTCCCACATTCTTTTCCCCACAAA

>1068
CACCACAACCACCACCACCCCCCACTTCATATATCAATATACAACCAACATCCTCCCTCAAACTAATCCAAAACCTCCCC
CCAAAAA

>1073
CCAAAAAACAAATCAAAAATCCAATAATTCCACTTTTTAAATTACCTTCTCTATATATAACTCAAACAACA

>1088
CCCACAATCACCTCCTCCTTCTCCCTAATATACACCCCCACACCACACATCCAATCAATCATCTTTTTTTCCAAAATTTT
TCCCCCAAACTAAAAACATATCCCCATACCCCCCCCCCCCCCTTATTATTTTAA

>1114
ACTCACACAAAATTCCCAATCTAAAATCACATTCACTATTCACTTTCTAATATTTCCTTAAAATACATAAAACCAAAAAT
CCTATTTTCACTACACAC

>1122
CAAAAACCCCAAAAACCTTTCCTTTCTTCCCCTTTAAAATAAACTCCATCAACCCTAAATAAAAATCCTCCCAAACAAAA
AA

>1145
TTTCCTCTTTTTTTTTTTTTTCTCCTTTTTTTTTATTATTTATTATATATCTTAACATTTAATAATTACTTAATTTTATA
TTCTCTCCTTTTTTTTTTCTCTTTTTTTTAAATTTCCTAATTTTAATTATTTCACAATTCTAATTTCCACATTTATAG

>1146
CCCTACTCATACTCTCCACTACCCAACACTCCTTCAATTAAATTTAATTCATTACCTTATACTACCATTAACACCCAAAA
AATTTCTCACTTTTATTTTTAATTTTTCTATCAAATTAAATCCATCCATTA

>1157
CTCTAATTTTCATCCATTTCCCACCTTTACAACAAAACCTAAAATAAAATTTCCCAATTCAACTTCCAAACAATCTCTTA
ATTATCTTCCAATAATACTCATTAAAAAAATTCTCCAACCAACC

>1161
ACACTCATATCCAATTTATATCTCCAAAAAACTCATATAATACCCTACATTACTTATTCCCAACCACCTACAACAAAATC
TCATCATTTAAA

>1164
TCTCCTATCTTCTTATAA

>1187
AAAACCACAACAAAAAAACCAAAAAACCCAAAAACTCCCCTTCTCCTTCTCTCAATAAATCATAATTCTCCTTTTCTCCT
TTCTTCTTTTTTTTTATACCATAAATATACCTAATAA

>1196
CTCCACACACTCTACAAATCATCAACTATCCCCCAACACTCTCCCTTCCCCTTCCCCCCCCTAAACTAATCCCAAAAAAA
AACCCCACCACAACCCCAAAAAAAAA

>1206
CTTCAAACCCCACAAACCTACATATACCTACAAAATTCACCAACAA
 
IP Logged
 
Reply #1 - Sep 24th, 2012 at 4:07pm

Yuriy Vaskin   Offline
Global Moderator

Gender: male
Posts: 138
*****
 
Hello Karen,

thank you for using UGENE.

Usually a frequency matrix is built over sequences of the same length and without gaps. For instance, in your data, minimum sequence length is 18. So positions of a frequency matrix greater than 18 would not make sense.

You can try to cut you alignment using "Edit" context menu of MAlignment view or delete some sequences.

By the way, for what do you need the matrix? Maybe there is another way in UGENE to do that.
 
IP Logged
 
Page Index Toggle Pages: 1