UGENE Forum | |
https://forum.ugene.net/forum/YaBB.pl
General Category >> Bugs and Issues >> Minor issue copying sequence from circular molecules https://forum.ugene.net/forum/YaBB.pl?num=1296558278 Message started by Agu on Feb 1st, 2011 at 6:04pm |
Title: Minor issue copying sequence from circular molecules Post by Agu on Feb 1st, 2011 at 6:04pm
Hi!
When copying a sequence over the +1 site of the sequence, the sequence is "splitted" by a new line. Although, that shouldn't be like that (because the real molecule is circular), the real issue comes copying the reverse complementary. To make it easier, lets say that the circular sequence (2000 bp) "ends" with "Ts" and starts with "As": Original sequence: |+1 GGGAGGAGGAGGAGGAGTTTTTTAAAAAATAATAATAATAATAATAATAA 2000| Copying that region (Ctrl +c), UGENE returns: GGGAGGAGGAGGAGGAGTTTTTT AAAAAATAATAATAATAATAATAATAA Removing the new line solves the problem: GGGAGGAGGAGGAGGAGTTTTTTAAAAAATAATAATAATAATAATAATAA But copying the reverse complementary (Shif + Ctrl +c) returns: AAAAAACTCCTCCTCCTCCTCCC ATTATTATTATTATTATTATTTTTT Here removing the new line creates a sequence that doesn't exist: AAAAAACTCCTCCTCCTCCTCCCATTATTATTATTATTATTATTTTTT The end result should be (reverse complementary to the original): TTATTATTATTATTATTATTATTTTTTAAAAAACTCCTCCTCCTCCTCCC Feature request: In the latest versions of UGENE it is possible to copy trough the +1 position like shown above. Nevertheless, that is only possible manually selecting the sequence with the circular view, but not with the Select range dialogue (Ctrl +a). It would be nice to have that option as well. Thanks UGENE v 1.9.0 |
Title: Re: Minor issue copying sequence from circular molecules Post by Mikhail Fursov on Feb 1st, 2011 at 11:40pm
Thank you for the report!
Fixed in 1.9.1 |
UGENE Forum » Powered by YaBB 2.5 AE! YaBB Forum Software © 2000-2010. All Rights Reserved. |